Skip to main content

Questions tagged [virus]

Biological kingdom of 'microparasite' that is unable to replicate without hijacking the hosts replication machinery

0 votes
0 answers
19 views

Estimating rate of evolution from a phylogeny

Any suggestions for the best way to estimate a metric for evolutionary rate of viral sequences of the same species? I was using terminal branch length from a phylogeny and would quite like to try sub ...
Nitara Wijayatilake's user avatar
1 vote
1 answer
70 views

Choosing the best number of species for assay

I am doing amplicon sequencing of a virus across many different regions. Lets say I have 20k unique variants of the same virus that I put into my pcr assay and after sequencing and amplifications I am ...
TheNumber23's user avatar
3 votes
1 answer
109 views

What is the limit of partition incompleteness in Bayesian MCMC?

I am seeking advice on whether or not to incorporate incomplete data into my BEAST analysis. I have HIV data consisting of two partitions of the pol gene: one that is 1.2 kb in length and present in ...
Vovin's user avatar
  • 435
1 vote
0 answers
15 views

DNASTAR viral-host integration assembly keeps failing

I have two NGS files from an NGS company corresponding to the sequencing data from a tumor sample as follows: TB_7710391_R1.FASTQ.gz TB_7710391_R2.FASTQ.gz I have downloaded the genome for MCPyV as ...
InterestingQuestions61's user avatar
1 vote
2 answers
87 views

How can I detect MCPyV in a FASTQ file?

I have received two NGS files from an NGS company, both are FASTQ files that correspond to reads from a tumor sample. I heavily suspect that MCPyV is present, and I am hoping to identify it. What ...
InterestingQuestions61's user avatar
4 votes
2 answers
181 views

relation between Illumina sequencing primer and viral sequences

Dealing whith a problematic sequencing run I found this over-represented sequence: GGAAGAGCACACGTCTGAACTCCAGTCACTAGCTTATCTCGTATGGCGTCTTCTGCTTG It is clearly relate to the Illumina sequencing primer ...
mox's user avatar
  • 333
1 vote
1 answer
100 views

Is current AI able to generate RNA sequences of viruses? [closed]

After seeing a video of a combination of CRISPR and AI, and an article of someone who made two babies immune against HIV and still healthy, I wondered about something. If such complicated thing, to ...
Random user's user avatar
3 votes
1 answer
66 views

Metagenomics pipeline recommendations for short-read data

de novo metagenomics on viral NGS data is a hot-topic. On this site alone at least 4 specific algorithms have been used to identify multi-strain/multi-species for a given data set, however these do ...
M__'s user avatar
  • 12.8k
-1 votes
2 answers
57 views

How to use GEO_SPHERE?

I have some problems with geosphere package which extends/applies the Beast Bayesian MCMC package for calculating phylogenetic trees. Please, could anyone give any hints about at least one of them? ...
Vovin's user avatar
  • 435
3 votes
2 answers
170 views

How to get the number of complete phage genomes available on ncbi?

I am looking to establish the total number of complete phage genomes available on NCBI. I am not looking for any specific type, but want to understand the total diversity available. How can I perform ...
pietro_molina's user avatar
2 votes
1 answer
58 views

Demovir produces an empty output

I am new to bioinformatics and am working on viral metagenomic (virome) datasets and so would like to use Demovir* for doing taxonomic annotations on my viral contigs. First, I installed all ...
Ernie Hsieh's user avatar
2 votes
1 answer
576 views

Entrez (Biopython) esearch and efetch not returning sequence as expected

I'm trying to use Entrez (through Biopython) to download the sequence of a TMV replicase gene. I have the following code: ...
blammo69's user avatar
3 votes
2 answers
89 views

Gold standard benchmark

This page is claimed to contain a gold standard benchmark for viral genome assembly. https://github.com/cbg-ethz/5-virus-mix The claim is here: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5411778/ ...
juanjo75es's user avatar
3 votes
1 answer
140 views

What is the origin of HIV1?

What is the origin of HIV1? This is the alignment of a small part of the POL protein of the HIV1 virus GenBank KU749412.1, with the POL protein of the Visna virus GenBank L06906.1 ...
RosLuP's user avatar
  • 215
1 vote
1 answer
67 views

Align the HIV-1 Gag protein with the Gag protein of Visna virus

Align the HIV-1 Gag protein with the Gag protein of Visna virus Background Visna virus is a lentivirus causing encephalitis in sheep The problem is align the follow two protein Gag of viruses HIV-1 (...
RosLuP's user avatar
  • 215

15 30 50 per page